1. Home
  2. Species
  3. Glycine max
  4. Sequence
  5. Glyma.10G145600

Glyma.10G145600


Description : Plant neutral invertase family protein


Gene families : OG_42_0001526 (Orthogroups_2024-Update) Phylogenetic Tree(s): OG0001526_tree

Sequence : coding (download), protein (download)


Download

Note:Only the main profile, including all conditions, is shown. Additional statistics and tissue specific profiles are available here.


Type Description Actions
Neighborhood Glycine release: Glyma.10G145600
Cluster HCCA clusters: Cluster_340

Target Alias Description ECC score Gene Family Method Actions
A4A49_31701 No alias alkalineneutral invertase e, chloroplastic 0.05 Orthogroups_2024-Update
At5g22510 No alias Alkaline/neutral invertase E, chloroplastic... 0.03 Orthogroups_2024-Update
Bradi2g12427 No alias Plant neutral invertase family protein 0.04 Orthogroups_2024-Update
HORVU2Hr1G072590.1 No alias alkaline sucrose-specific invertase *(CIN) 0.02 Orthogroups_2024-Update
Seita.5G157600.1 No alias alkaline sucrose-specific invertase *(CIN) 0.03 Orthogroups_2024-Update
Seita.7G089000.1 No alias alkaline sucrose-specific invertase *(CIN) 0.03 Orthogroups_2024-Update
Solyc11g067050 No alias ATGTTATTTCATGTAAATGTGTTGATTAAATCCAGAAATTATTACAATAGCTGCAAAGCT 0.03 Orthogroups_2024-Update
Sopen01g023510 No alias Alkaline and neutral invertase 0.02 Orthogroups_2024-Update
Sopen01g044310 No alias Alkaline and neutral invertase 0.03 Orthogroups_2024-Update

Type GO Term Name Evidence Source
MF GO:0033926 glycopeptide alpha-N-acetylgalactosaminidase activity IEA InterProScan predictions
Toggle parental
Type GO Term Name Evidence Source
MF GO:0004594 pantothenate kinase activity IEP Predicted GO
MF GO:0004672 protein kinase activity IEP Predicted GO
MF GO:0005096 GTPase activator activity IEP Predicted GO
MF GO:0005524 ATP binding IEP Predicted GO
CC GO:0005667 transcription factor complex IEP Predicted GO
CC GO:0005669 transcription factor TFIID complex IEP Predicted GO
BP GO:0006352 DNA-templated transcription, initiation IEP Predicted GO
BP GO:0006813 potassium ion transport IEP Predicted GO
MF GO:0008047 enzyme activator activity IEP Predicted GO
MF GO:0008144 drug binding IEP Predicted GO
MF GO:0008483 transaminase activity IEP Predicted GO
MF GO:0015077 monovalent inorganic cation transmembrane transporter activity IEP Predicted GO
MF GO:0015079 potassium ion transmembrane transporter activity IEP Predicted GO
MF GO:0015318 inorganic molecular entity transmembrane transporter activity IEP Predicted GO
BP GO:0015672 monovalent inorganic cation transport IEP Predicted GO
BP GO:0015936 coenzyme A metabolic process IEP Predicted GO
BP GO:0015937 coenzyme A biosynthetic process IEP Predicted GO
BP GO:0016051 carbohydrate biosynthetic process IEP Predicted GO
MF GO:0016301 kinase activity IEP Predicted GO
MF GO:0016769 transferase activity, transferring nitrogenous groups IEP Predicted GO
MF GO:0016772 transferase activity, transferring phosphorus-containing groups IEP Predicted GO
MF GO:0016773 phosphotransferase activity, alcohol group as acceptor IEP Predicted GO
MF GO:0016790 thiolester hydrolase activity IEP Predicted GO
MF GO:0017076 purine nucleotide binding IEP Predicted GO
MF GO:0030554 adenyl nucleotide binding IEP Predicted GO
MF GO:0030695 GTPase regulator activity IEP Predicted GO
MF GO:0032553 ribonucleotide binding IEP Predicted GO
MF GO:0032555 purine ribonucleotide binding IEP Predicted GO
MF GO:0032559 adenyl ribonucleotide binding IEP Predicted GO
BP GO:0033865 nucleoside bisphosphate metabolic process IEP Predicted GO
BP GO:0033866 nucleoside bisphosphate biosynthetic process IEP Predicted GO
BP GO:0033875 ribonucleoside bisphosphate metabolic process IEP Predicted GO
BP GO:0034030 ribonucleoside bisphosphate biosynthetic process IEP Predicted GO
BP GO:0034032 purine nucleoside bisphosphate metabolic process IEP Predicted GO
BP GO:0034033 purine nucleoside bisphosphate biosynthetic process IEP Predicted GO
BP GO:0034220 ion transmembrane transport IEP Predicted GO
BP GO:0034637 cellular carbohydrate biosynthetic process IEP Predicted GO
BP GO:0034654 nucleobase-containing compound biosynthetic process IEP Predicted GO
MF GO:0035639 purine ribonucleoside triphosphate binding IEP Predicted GO
MF GO:0036094 small molecule binding IEP Predicted GO
MF GO:0043168 anion binding IEP Predicted GO
CC GO:0044428 nuclear part IEP Predicted GO
CC GO:0044451 nucleoplasm part IEP Predicted GO
CC GO:0044798 nuclear transcription factor complex IEP Predicted GO
MF GO:0046873 metal ion transmembrane transporter activity IEP Predicted GO
MF GO:0060589 nucleoside-triphosphatase regulator activity IEP Predicted GO
BP GO:0071805 potassium ion transmembrane transport IEP Predicted GO
CC GO:0090575 RNA polymerase II transcription factor complex IEP Predicted GO
MF GO:0097159 organic cyclic compound binding IEP Predicted GO
MF GO:0097367 carbohydrate derivative binding IEP Predicted GO
BP GO:0098655 cation transmembrane transport IEP Predicted GO
BP GO:0098660 inorganic ion transmembrane transport IEP Predicted GO
BP GO:0098662 inorganic cation transmembrane transport IEP Predicted GO
MF GO:1901363 heterocyclic compound binding IEP Predicted GO
InterPro domains Description Start Stop
IPR024746 Glyco_hydro_100 171 610
No external refs found!